Genetic Genealogy

Irish Family History: intermediate level

7 p.m. Tuesday 13 November 2018 and Tuesday 20 November 2018

Emmet Theatre, TCD

by Paddy Waldron

WWW version:

http://pwaldron.info/TCD/

YouTube version:

13 November - 20 November TBA

***** NB: FamilyTreeDNA kits will be available after this talk for anyone interested via the DNA Outreach IRL project *****

Outline

• Week 1:
• Context
• Definitions
• Components of DNA
• Inheritance paths
• Mutations
• Recombination
• Week 2:
• Using the DNA websites
• Identity v. Anonymity
• Case studies

Context

• You are the expert on your own famliy history as you have
• the family's oral traditions in your memory;
• the family papers in your attic, or wherever they are kept; and
• the family DNA in every cell of your body.
• The genealogist's task is to compile family histories by matching up these three categories of private information
• with each other; and
• with public information.
• According to Wikipedia, genetic genealogy is

  the use of DNA "testing" in combination with traditional genealogical methods to infer relationships between individuals and find ancestors.

• "Testing" does not mean just sending a DNA sample to a laboratory; it means using DNA to test a hypothesis derived from traditional genealogical methods.
• The DNA companies are not "testing companies" or "testing laboratories" - they just provide the tools for the genealogist to test his or her own hypotheses.
• The genealogist must organise all the relevant information (oral and paper-based, private and public, traditional and DNA) in an easily searchable lineage-linked computer database format.
• e.g. Ancestral Quest, which I use, or RootsMagic or Reunion or Family Tree Builder or any of the numerous other programs listed on Wikipedia; or even in the "cloud" (if you have superfast broadband and believe that clouds never evaporate, or have a good backup policy).
• The database can be uploaded from time to time to a website if desired, and the part detailing your direct ancestors must be uploaded in conjunction with your DNA data.
• The traditional linear family history narrative that might be published in book format can be:
• generated automatically from the database;
• contained in free-form notes fields within the database; or
• produced as a separate stand-alone end product, using the database as a guide.
• Genealogical records have been created by the actions of our ancestors and of ourselves:
• We are the first generation to create digital records of our DNA.
• The value of DNA comparison to genealogists increases dramatically with the number of people from the relevant geographical area and relevant extended family group already in the DNA databases used.
• See recent report on database sizes (which does not stress the U.S. bias in most of the databases).
  
• Submitting your DNA to a database has significant positive externalities for existing and future researchers.
  
• We still need to persuade more known and possible Irish relatives to submit DNA samples to the databases for purely genealogical purposes.
• Your descendants will be eternally grateful to you for leaving them your DNA.
• Do unto them as you wish your ancestors had done unto you.
• Your own DNA (and especially the DNA of any living parents or grandparents) is one of your most important genealogical sources.
• Deciding not to use your DNA is now the equivalent of deciding not to use census returns.
• The DNA evidence often fills gaps in the traditional evidence, but sometimes refutes it (NPE).
• DNA has let the genie out of the bottle as regards secret adoptions and fosterings.
• If you want to keep family secrets secret, then keep your own DNA and the DNA of all of your relatives out of the online databases.
• Treat family secrets and those directly involved as sensitively and sympathetically as possible.
• These two sessions will teach you methods to get the most out of your DNA as a source.
• The objectives are to learn how to
• interrogate and extract relevant evidence from your DNA, as you would with any other source; and
• to find hints and leads from the online DNA databases to other surviving sources.
• Your DNA will link you to genetic communities:
• You will find groups of DNA matches whose most recent common ancestor (MRCA) with you may be just over the present brick walls in your family tree.
• Research has established that people whose ancestors lived close to each other geographically are now themselves close to each other genetically.
• The converse is not necessarily true: people from Place A may share DNA with people from Place B, but their most recent common ancestors may have lived in Place C.
  
• The correlation between genes and geography allows the DNA companies to peddle estimated ethnicity percentages, almost inevitably presented without any mention of the associated margin of error.
• The DNA companies are still looking for GAA people (people with Geographically Anchored Ancestry) to form reference populations and provide improved estimates.
• You will soon begin to recognise "all the usual suspects" in DNA match lists.
• Your DNA will also make you part of new research communities:
• FamilyTreeDNA.com hosts three types of DNA projects, co-administered by people like me:
• geographically-based, e.g.:
• Clare Roots (co-administator Terry Fitzgerald, WA, USA; 1153 members as of 17 October 2018)
• Kerry Y-DNA Project (administrator John Hallissey, Waterford; 69 members)
• surname-based, e.g.:
• Clancy (administrator Fergus Clancy, Dublin; 90 members)
• Durkin/Durkan/Durcan (administrator Mike Durkin, NY, USA; 28 members)
• Marrinan (administrators Cory Marinan, WI, USA; Cindy Wood, MI, USA; Greg Marrinan, CT, USA; 33 members)
• McNamara (rescued from worldfamilies.net and GDPR; 102 members)
• O'Dea/O'Day/Dee (administrator James O Dea, Dublin; 96 members)
• haplogroup-based, e.g.:
• R-M222 and Subclades (Irish Type I) (2251 members)
• R1b-CTS4466 Plus (Irish Type II) (891 members)
• R-L226: The Irish Type III cluster (611 members, including some of the Clancys, McNamaras and O'Deas)
• Genetic Genealogy Ireland conferences are held twice yearly to coincide with Back to our Past and are video-recorded:
• Belfast in February (since 2018, second renewal 15-16 February 2019)
• Dublin in October (since 2013, 2019 dates TBA)
• The International Society of Genetic Genealogy (ISOGG) is free to join.
• There are many relevant and very active Facebook groups, e.g.:
  
• ISOGG
• Genetic Genealogy Ireland
• Genetic Genealogy Tips & Techniques

Definitions

Components of DNA

• What is DNA?
  • short for deoxyribonucleic acid
  • made up of chromosomes and mitochondria, each consisting of molecules of four nucleotides named adenine (A), cytosine (C), guanine (G) and thymine (T)
  • represented by strings of the letters A, C, G and T
  • DNA labs turn saliva or cheek swabs into data files of As, Cs, Gs and Ts:

    RSID CHROMOSOME POSITION RESULT
    
    rs4477212 1 72017 AA
    
    rs3094315 1 742429 --
    
    rs3131972 1 742584 GG
    
    rs12562034 1 758311 --
    
    rs12124819 1 766409 --
    
    rs11240777 1 788822 AG
    
    rs6681049 1 789870 --
    
    rs4970383 1 828418 CC
    
    rs4475691 1 836671 CC
    
    rs7537756 1 844113 AA
    
    

  • these data  files can be copied to other DNA comparison websites
• Where does our DNA come from?
  • DNA is inherited by every child from its parents,
  • largely deterministically, but with
  • some random variation.
  • When a sperm fertilises an egg, each brings DNA, which is replicated in every cell of the resulting person.

Inheritance paths

Y chromosome

Only males have a Y chromosome.
Y-DNA comes down the patrilineal line - from father, father's father, father's father's father, etc.
This is the same inheritance path as followed by surnames, grants of arms, peerages, etc.

X chromosome

Males have one X chromosome, females have two.
X-DNA may come through any ancestral line that does not contain two consecutive males.
Blaine Bettinger's colour-coded blank fan-style pedigree charts show the ancestors from whom men and women can potentially inherit X-DNA.

Autosomes

Short for autosomal chromosomes

Exactly 50% of autosomal DNA (atDNA) comes from the father and exactly 50% comes from the mother.
Due to recombination, on average 25% comes from each grandparent, on average 12.5% comes from each greatgrandparent, and so on.

In extreme cases, an individual can inherit up to 35% from one paternal grandparent and, hence, as little as 15% from the other paternal grandparent.
Siblings each inherit 50% of their parents' autosomal DNA, but not the same 50% (except for identical twins).
Similarly, siblings each inherit 50% of their mother's X-DNA, but not the same 50% (except for identical twins).
Sisters each inherit 100% of their father's X-DNA.

Mitochondria

Everyone has mitochondrial DNA (mtDNA).

Mitochondrial DNA comes down the matrilineal line - from mother, mother's mother, mother's mother's mother, etc.
The surname typically changes with every generation in this line.

• Autosomal DNA is the cheapest component to analyse and has rapidly become the most widely used in genealogy.
• Y-DNA has been widely used for one name studies or surname projects for much longer, but has also seen rapid recent scientific advances.
• Targeted mitochondrial DNA and X-DNA comparisons can be used to solve more specialised problems.

Mutations

• Short Tandem Repeat (STR): a string of letters consisting of the same short substring repeated several times, for example CCTGCCTGCCTGCCTGCCTGCCTGCCTG is CCTG repeated seven times; it may be repeated less or more often in other individuals.
• Single Nucleotide Polymorphism (SNP): a single location where two (or occasionally more than two) different letters are observed in different individuals.

Y-DNA Mutations

• The Y chromosome is passed virtually unchanged from father to son.
• But the cumulative effect of occasional mutations over hundreds of thousands of years has resulted in wide variations in the Y chromosome today.
• Early Y-DNA analysis looked at the numbers of repeats for each of 12 STR markers on the Y chromosome.
• Now Surname Projects look at 111 STRs.
• The state-of-the-art Big Y-500 product reports values for 500+ STRs.
• Genetic distance between two men is, roughly speaking, the number of differences between their STR signatures, e.g. 0/12 or 9/111.
• The smaller the genetic distance between two men, the closer their expected relationship.
• The correlation between genetic distance and degree of relationship is not perfect:
• When an STR mutation occurs, the subject of the mutation is genetic distance 1/37 (say) from his father;
• until the next STR mutation occurts, all descendants of the subject of the mutation are genetic distance 0/37 from their most recent common ancestor.
• Surname spellings also mutate, independently of DNA mutations.
• Some SNP mutations on the Y chromosome are once-in-the-history-of-mankind events and can be used to build a Y-DNA Haplotree, which has evolved from the original Simplified Tree of Y-Chromosome Haplogroups (top level haplogroups A-R are about 20,000 years old).
• Surname-specific SNPs are now being discovered.
  

mtDNA Mutations

• mtDNA mutations are much rarer, so less useful genealogically.
• Perfect mtDNA matches may have to go back dozens of generations to find a common ancestor.
• There is also an mtDNA Haplogroup Tree.

Autosomal DNA Mutations

• The DNA companies observe only 0.02% or so of the locations on the autosomes
• These are the locations known to have SNP mutations.
• All observed mutations are weighted equally in current relationship predictions, but two individuals who share a recent mutation observed in only 1% of the population are likely to be far more closely related than two individuals who share an old mutation observed in 50% of the population (GEDmatch Genesis is working on better relationship predictions).

Recombination

• Every sperm and egg is potentially unique.
• Recombination of the paternal and maternal chromosomes is sometimes compared to shuffling two decks of playing cards.
• Recombination rates vary markedly along the autosomes and the X chromosome.
• The local recombination rate is referred to as genetic length and is measured in units called centiMorgans, which estimate the number of generations to the common ancestor of two individuals sharing an identical long run of letters.
• One recombination per generation is expected in each 100 centiMorgans (cM, not cm).
• On average, there are 798,852 total letters per cM or 190 letters observed per cM, or one recombination or crossover per generation per 19,000 observed letters.
• The greater the genetic length of the DNA shared by two individuals, the closer the expected relationship.
• The correlation between shared centiMorgans and degree of relationship is not perfect.
• See charts by Shared cM Project and TheDNAgeek.

Using the DNA websites

• GEDmatch.com
• FamilyTreeDNA.com
• AncestryDNA
• MyHeritage.com (changes to be announced before 1 December 2018)

• it essentially withdrew from the market by showing many, if not all, of its customers the message "We are continuing to modify some aspects of DNA Relatives in preparation for the transition to the new 23andMe experience" from October 2015 until at least May 2017;
• it withdrew further from the market in August 2017 by becoming the first of the large companies to switch to a GSA chip which is not compatible with the current regular GEDmatch upload; and
• it appears to have stopped hosting any type of family trees for its DNA customers.

Add DNA information to your genealogy database:

• Record the ancestors and cousins confirmed by your DNA in your genealogy database.
• Use an event field or note tag in your database to track people who are in both your own database and the DNA databases.

Add genealogy information to the online DNA databases:

• Export a GEDCOM file containing at least the ancestors of each DNA subject and upload it to all the DNA websites so that matches can see a pedigree chart.
• Examples of pedigree charts: from Ancestral Quest, AncestryDNA, ancestry.com, FamilyTreeDNA and GEDmatch.
• For FamilyTreeDNA.com, include in the GEDCOM file any third cousins or closer already at FTDNA and the shared ancestors; FTDNA will use these linked relationships to assign other matches to the DNA subject's paternal and maternal sides (example).

GEDmatch.com tools

• User Registration
• Generic Upload FAST (DNA data)
• GEDCOM genealogy Upload Fast Beta version
• 'One-to-many' matches
• 'One-to-one' compare
• People who match one or both of 2 kits
• Are your parents related? (e.g. T409076)
• Tag groups
• Autosomal DNA comparison matrix (see case study below)
• Tier 1 Utilities
• Matching Segment Search
• Lazarus
• etc.
• etc.

FamilyTreeDNA.com tools

• Dashboard
• Matches
• Chromosome Browser
• Linked Relationships
• Download Raw Data
• Build 36 Raw Data Concatenated (bottom right) for GEDmatch
• Build 37 Raw Data Concatenated (bottom left) for MyHeritage

AncestryDNA tools

• Test Settings
• Family Tree Linking
• Download Raw DNA Data
• Share your match list (+ Add a person)
• Match list
• Search Matches (by surname or by birth location, if available on the dropdown)
• search results appear incomplete for new kits
• Match page
• Shared Matches

Identity v. Anonymity

• There is a trade-off between:
•  increasing your chances of finding long-lost cousins and ancestors (and being found by long-lost cousins); and
• maintaining the privacy of your family history research and DNA results.
• If you keep your DNA results or known family tree private, then nobody will be able to find you and you will not be able to find any DNA matches.
• If you want to be found, then you must let your potential cousins see your DNA results and your known family tree.
• If you give your matches no information, then they can not help you.

• Some customers of the DNA companies appear to wish to maintain a certain degree of privacy and anonymity.
• Others find it paradoxical that those trying to identify their anonymous ancestors can be so concerned about anonymising their own identity.

• GEDmatch.com explicitly allows familial comparisons of DNA recovered from a crime scene to identify a perpetrator of a violent crime against another individual.

Reveal the DNA subject's birth surname:

Most people inherit DNA with their birth surname, so identify yourself as a minimum by your birth surname with an initial or a title, e.g., P Waldron or Mr Waldron or Miss Durkan.

Reveal the gender of the person who provided the DNA sample:

Valuable additional inferences can potentially be drawn once it is known whether two X chromosomes (female) or one X chromosome and one Y chromosome (male) are potentially available for comparison.
Women do not have Y-DNA and are encouraged to recruit their male relatives to provide Y-DNA, but they must NOT attach a female name to a male DNA sample, as this causes untold confusion.
Be especially careful not to inadvertently link a male's Y-DNA results with a female's autosomal DNA results at FamilyTreeDNA.com where error-checking does not look for this.
Also take care not to link a male DNA sample to a female's pedigree chart.

Avoid providing irrelevant information:

Your first name, married surname, adopted surname or marital status reveal nothing about your DNA, so you may keep these private if you wish.

Avoid pseudonyms:

They reduce the chances that your matches will bother to look at your family tree, contact you or share the information about your ancestry that they have and that you do not have.

Be consistent and avoid unnecessary confusion:

A real example (further anonymised):

• Ancestry username: tara1234
• AncestryDNA samples from mother and daughter (per e-mail exchange)
• linked to pedigree charts of an aunt and niece
• appear to matches as M.R. (managed by tara1234) and D.C. (managed by tara1234)
• neither of these are the real initials
• the daughter is an AncestryDNA match to her mother's probable 4th cousin, but the mother is not (false negative?)
• only one of the two kits is at GEDmatch
• GEDmatch alias and e-mail address both begin with Molly
• Molly is the dog's name
• it took me 300 days after the upload to GEDmatch to associate the AncestryDNA and GEDmatch identities

Keep all your DNA-related correspondence in a single searchable e-mail archive

Use the internal messaging system and AncestryDNA/MyHeritage/23andMe or Facebook messages only to exchange e-mail addresses.

Case studies

The blackberry baby

• video

O'Deas of Moveen West

• Tithe Applotment Book 17 Nov 1827
• John O'Dea D's
• John O'Dea & Lot Foley's Mountain
• O'Dea     John
• John O'Dea Breacfa
• Reports and Returns Relating to Evictions in the Kilrush Union (1847-1849)
• 15 May 1849: No O'Dea
• 2/3 June: No O'Dea
• Griffith's Valuation 1855 (image 1 image 2)
• widow Mary Lynch née O'Dea, no. 9a.
• Michael O'Dea, no. 21a
• John Westropp was immediate lessor or head landlord in most of Moveen East;
• Ralph Westropp was immediate lessor or head landlord in Moveen West and no. 26 in Moveen East - bog (turbary), with no tenants listed.
• Occupiers in Ralph Westropp's bog probably included:
• Denis O'Connell (d. 1887) and his wife Kate née O'Dea (d.1889, said to be sister of Mary Lynch) and family
• Pat O'Dea and son John (b. Abt 1845/6, d. 1907)
• Belfast News-Letter Monday 28 May 1888
  `TIDAL WAVE ON THE CLARE COAST.
  FIVE PERSONS DROWNED.
  Kilrush, Saturday [26 May 1888]. - Five persons were drowned this [sic] morning by a tidal wave on the Clare coast, near Goleen Bay, half way between Kilkee and Carrigaholt. The unfortunate people were collecting seaweed when the wave suddenly overtook them, and carried them out to sea. They were Michael Lynch [son of Mary], his son, and daughter, and Michael O'Dea and his son, both men being farmers. Their bodies have not been recovered.'
• Were the Lynch and O'Dea victims related?
• STATE OF IOWA IN THE DISTRICT COURT
  Scott County
  In the matter of the estate of Ellen McGrath deceased.
  To said Court:
  Your Petitioner respectfully shows: That Ellen McGrath, whose residence was at Davenport, in the township of City of Davenport in said County of Scott, died at Davenport on or about the 12th day of May, A. D. 1900, that at the time of her death she was an inhabitant of the County of Scott, that the said deceased was born at County Clare, Ireland, on or about the _____ day of _____, A. D. 1820, that she left no will, so far as your petitioner has heard or been able to discover; and the diligent search has been made therefore, that she left no husband or children and her only heirs are her sisters, being Nora Griffin, residing at Dorchester, Iowa; Bridget Foley, residing at Davenport, Iowa; and the following nieces and nephews, to wit: -- Kate O’Dea ______, residing at Danbury, Connecticut; Ellen Costello, residing at Danbury, Connecticut; Mary Ann O’Dea, living in Connecticut; Pat O’Dea, Tom O’Dea, Kate O’Dea and Bridget O’Dea all living in County Clare, Ireland. John O’Dea, living in County Clare, Ireland; Martin McLaughlin, Celia McLaughlin, _________ McLaughlin, and _______McLaughlin, living at Dorchester, Iowa; and this petitioner whose residence is Davenport, Iowa.
  Your petitioner further shows that all the goods, chattels, and credits of said deceased do not exceed in value the sum of one hundred Dollars, and your petitioner prays that Letters of Administration may be granted by this Court to Michael O’Dea, whose residence is at Davenport and who is a suitable person to administer said trust.
  Dated May 14, 1900
  Michael O’Dea, petitioner,
  By Schnider & Vollmer, his attorneys
  STATE OF IOWA
  Scott County ss Michael O’Dea
  On this 14th day of May, 1900 personally appeared Michael O’Dea the above-named petitioner, an being duly sworn, made oath that the matters set forth in the above petition are true.
• Census 1901
• house 22 in Moveen West - Norah Lynch, daughter-in-law of Mary, and family
• house 13 in Moveen West - Honor O'Dea, widow of Michael, and her children Patrick, Thomas, Bridget and Peter
• house 6 in Moveen West - Michael O'Connell, son of Denis O'Connell and Kate O'Dea, and family on Ralph Westropp's Moveen East bog
• house 5 in Moveen West - John O'Dea and family on Ralph Westropp's Moveen East bog
• Can DNA comparisons tell us how the four O'Dea families of Moveen West were related?
• In the Autosomal DNA comparison matrix:
• the first three rows (7-9) are descendants of house 13 (greatgrandchild or more remote descendant of Michael of Griffith)
• the next two rows (10-11) are descendants of house 5 (GGgrandchildren of Pat, missing from Griffith)
• the next three rows (12-14) are descendants of house 6 (GGgrandchildren or more remote of Mrs O'Connell, missing from Griffith)
• the next 17 rows (15-31) are descendants of house 22  (GGgrandchildren or more remote of Mrs Lynch of Griffith)
• the last row has Moveen ancestry and all her AncestryDNA matches born in Moveen are O'Dea descendants.
• The DNA evidence confirms that Mrs. O'Connell and Mrs. Lynch were sisters (over 90cM shared between descendants who are no closer than fourth cousins).
• The DNA evidence is strong enough to confirm that the John O'Dea listed as an heir in the intestacy case is John of Moveen.
• More DNA evidence is required to determine the exact relationship between the progenitor of the O'Deas in house 5 and house 13 and the progenitor of the O'Connells and Lynches in house 6 and house 22.

Further reading

• See here for all the technical details of how and why to upload your DNA data and pedigree charts to the various websites.